5) 9 (16) 9 (26) 7 (44) Grade 2 151 (62) 70 (55) 56 (76) 38 (67) 21 (62) 7 (44) Grade 3 28 (12) 16 (12.5) 7 (9.5) 9 (16) 3 (6) 2 (12) Do not recall 2 (1) 1 (0.5) 1 (1) 1 (1) 1 (3) 0 (0) Note: The Indian group was excluded due to small number of subjects * p < 0.025 Fractures in blacks associated with lower grades

of trauma than in whites ** p < 0.035 Fractures in black males associated with lower grades of trauma than in white males Discussion This study shows that fracture rates in children in South Africa vary across the different ethnic groups, with the percent of children reporting fractures in the white ethnic group being almost double that of the black and mixed ancestry groups. As far as we can ascertain, this is the first comparative study of children’s fractures across ethnic groups reported in the world. Numerous studies from developed countries selleck screening library have reported

on the incidence of childhood fractures in defined populations [3, 9–13] and in longitudinal cohort studies [14], but none have reported on ethnic differences in childhood fracture patterns and rates. The lower fracture incidence in black than white children is similar to that noted for femoral neck fractures in adults in South Africa [6]. The risk of osteoporotic fractures in the elderly is related to gender and ethnicity. The National Osteoporosis Risk Assessment (NORA) longitudinal observational study of osteoporosis check details among postmenopausal women in primary care practices compared white, Asian, Hispanic and Native American women in terms of osteoporosis risk and showed that these ethnic groups are more at risk for osteoporosis than African-American women [15]. Similarly African-American women have a lower fracture risk than white women at every level of bone mineral density and this relationship is largely explained by environmental

and genetic factors that need to be further investigated [16]. Although only 22% of children in the combined cohort reported fractures, Forskolin in vivo 41.5% of white children suffered one or more fractures; this latter figure being comparable to that found in the Dunedin Multidisciplinary Health and Development study whose participants were predominantly Caucasian [14]. The percentage of fractures in white boys and girls in the present study is also similar to those reported by Landin where by the age of 16 years, 42% of boys and 27% of girls had suffered a fracture [3]; however they are click here somewhat higher than those reported from a cross-sectional study in Poland, in which 30% of 1246 respondents had fractured by the age of 16 to 20 years [13]. In the current study, the fracture rate in white children were three-fold that found in the black and mixed ancestry groups and more males than females sustained multiple fractures, the latter finding being in keeping with other population based studies[3, 9, 12–14,17].

This fragment was amplified by PCR using the primers: gcgcaagcttggtgttgagggtgtcacgag and gcgcgagctctgcaccaagagagggtgagc. QuikChange Site-Directed Mutagenesis Kit (Stratagene) was used to Selleckchem Selumetinib generate pMIR-REPORT-Luciferase-B-Myb-3′-UTR-mutant plasmid by using learn more following primers: 5′-ggctcctgagattaacaacaaa-3′ and 5′-tttgttgttaatctcaggagcc-3′.

A plasmid coding β-galactosidase (pMIR-REPORT β-gal control) was used to normalize variability due to differences in cell viability and transfection efficiency. Cell transfection MDA-MB-453 cells were transfected with vector or plasmid encoding hsa-miR-29a precursor by using lipofectamine 2000. After drug-selection (0.5 mg/ml G418 for 7 days), cells were used in different experiments. Transfection of MDA-MB-453 cells for luciferase assay is described in detail below. Packaging of pseudoviral particles and transduction of the target cells MiRZip-29a plasmid or its vector control was transfected into 293TN cells and pseudoviral particles were collected following the provider’s protocol. Pseudoviral particles were applied on MCF-10A cells. 24

hours later, cells were subjected to drug selection (1 μg/ml puromycin) for 3 days. After drug-selection, cells were used in different experiments. Luciferase assay To directly evaluate CB-5083 in vivo the effect of mir-29a on B-Myb, we used the luciferase assay. MDA-MB-453 cells were first transfected with vector or plasmid encoding hsa-miR-29a precursor. After drug-selection, cells were transfected

with pMIR-REPORT-Luciferase-B-Myb-3′-UTR or its mutant using lipofectamine 2000. A plasmid encoding beta-galactosidase (pMIR-REPORT β-gal) was co-transfected with these plasmids. 48 hours later, luciferase activity was measured by using Luciferase Assay Kit following the manufactory protocol. Beta-galactosidase Thalidomide activity was measured by using β-Gal Assay Kit. The luciferase activity was normalized against the β-Gal activity from the same cells. Western blot Proteins extracted from different cells were subjected to electrophoresis on a polyacrylamide gel and then transferred onto PVDF membranes. After that, membranes were blocked with 5% fat free dry milk in TBS-T for 1 h. The primary antibodies were applied on the membranes at 4°C overnight before they were washed out by TBS-T. The membranes were then incubated with secondary antibodies for 1 h at room temperature in TBS-T. After four washes in TBS-T, chemiluminescent substrate (Pierce, USA) was applied onto the membranes and the films were processed in a dark room. TaqMan miRNA analysis The experiments were carried out following the manufactory protocol. Briefly, for RT reactions, 10 ng of total RNA was used in each reaction and mixed with the miRNA-specific RT primer. The thermal cyclers are as following: 16°C for 30 min, 42°C for 30 min, 85°C for 5 min. After the RT reaction, the products were diluted at 1:15, and 1.

suis persister cells in bacterial colonization of host tissues, general antibiotic tolerance, and recurrent infections. Methods Bacterial strains, media, and growth conditions All bacterial strains investigated in this study (listed in Table 1) were grown in complex Todd Hewitt Broth (THB,

Selleckchem Vismodegib Becton Dickinson Diagnostics) medium at 37°C. If not stated otherwise cryo-conserved bacterial stocks were used in the experiments. Preliminary experiments with GSK872 cell line cryo-conserved and freshly prepared bacterial cultures had revealed no significant differences in persister cell formation assays (data not shown), similar to what has been reported for E. coli[6]. For the preparation of bacterial stocks, overnight cultures were diluted to an optical density at 600 nm (OD600) of 0.02 in fresh THB medium and further incubated until bacteria reached either the early exponential (exp) or stationary (stat) growth phase as depicted in Additional file 2: Figure S1. Then 19 ml of exponential grown or 4 ml of stationary grown bacterial cultures were collected and centrifuged at 4000 × g for 10 min Torin 1 mw at 4°C. Bacterial pellets were washed once in phosphate-buffered saline, resuspended in THB medium containing 15% glycerol (v/v), and aliquots were immediately shock frozen in liquid nitrogen. Frozen cultures were kept at −80°C until

use and numbers of viable cells were determined by serial plating on sheep blood Columbia agar plates. All antibiotic treatments were performed in chemically defined medium, RPMI 1640 (Life Technologies), which is routinely used in cell culture. Table 1 Bacterial strains used in this study Strain Description Reference S. suis       10 Virulent serotype 2 strain, porcine isolate [56]   10ΔccpA Strain 10 ccpA

mutant; ccpA::EmR [39]   10ΔAD Strain 10 arginine deiminase operon mutant; arcA::SpcR [38]   05ZYH33 Virulent serotype 2 strain, isolate from human outbreak in China [40]   A3286/94 Virulent serotype 9 strain, porcine isolate [41] S. agalactiae       6313 A clinical isolate belonging to serotype III [57] S. gordonii       30   [58] S. pyogenes       A40 A clinical isolate belonging to M type 12 [59] Antibiotics and determination STK38 of minimal inhibitory concentration (MIC) Daptomycin (commercial Cubicin®) analytic grade powder was purchased from Novartis Pharma. Penicillin G, ciprofloxacin, amoxicillin, and rifampicin were purchased from Sigma, and gentamicin from Roth. The antimicrobial solutions were prepared freshly prior to each application according to the manufacturers’ recommendations. The MIC of each antibiotic was determined in duplicate by the microdilution technique in 96-well plates. Serial two-fold dilutions of different antibiotics prepared in RPMI 1640 medium were inoculated each with 5 × 105 colony forming units (CFU) of exponential grown cryo-conserved bacteria per well.

We then calculated the relative expression of each miRNA in each cell line by normalizing to the overall signal observed for each cell line measurement, and averaged duplicate spots and replicate cell line measurements. Hierarchical clustering analysis The miRNA expression data was log-transformed, normalized LY2874455 chemical structure by median centering, and then clustered using the Cluster and TreeView software packages [24]. The entire dataset was clustered both on cell lines and on miRNAs using average linkage hierarchical clustering based

on Pearson correlation. Linear discriminant analysis We defined three groups of cell lines based on annotated histology of the tumor from which the cell line was derived SCLC, NSCLC and HBEC. Each cell line can be considered a point in the multi-dimensional space defined by the miRNA expression.

Given the assignment of the cell lines into the three groups, we applied linear discriminant analysis (LDA, using the “”lda”" function as implemented in the R package MASS) [25, 26], which attempts to maximize the ratio of between-group variance to within-group variance of the dataset. The result is a linear combination of features FK506 that characterize or separate the groups and can be used to reduce the dimensionality of the data and to visualize the relationships between the groups in expression space. Statistical analysis The significance of differential expression of individual miRNAs between the groups was determined by two-tailed unpaired t-test, correcting for multiple comparisons using the Benjamini-Hochberg false discovery rate (FDR) method [27]. The trend in expression of each miRNA across the three groups of cell lines was tested using the Jonckheere-Terpstra

test, a non-parametric test for ordered differences among groups [28]. It is designed to detect alternatives of ordered group differences with expression of an individual miRNA increasing or decreasing monotonically across the three ordered groups (SCLCs, Ro 61-8048 NSCLCs and HBECs), which can be expressed as μSCLC ≤ μNSCLC ≤ μHBEC (or μSCLC ≥ μNSCLC ≥ μHBEC), with at least one of the inequalities Bay 11-7085 being strict, where μi denotes the mean expression of a given miRNA in group i. Results Hierarchical clustering classifies cell lines as distinct groups that are consistent with their histological classification In order to examine whether miRNA expression is informative in distinguishing SCLC cells from NSCLC cells as well as normal lung cells, we measured the expression levels of 136 miRNAs in a panel of cell lines by miRNA microarray. The panel comprised three groups of cell lines that were derived from human lung tumors or normal human lung tissue, including 9 SCLC cell lines, 7 NSCLC cell lines and 3 HBEC lines (Table 1). After normalization, we clustered the miRNA expression data using unsupervised clustering.

haemolyticum strains were compared to this. Staurosporine (1 μM), used as a positive control, was able to induce apoptosis, as measured by 2.76-fold, 1.27-fold and 1.56-fold increases in caspase 3/7, 8 and 9 activities, www.selleckchem.com/products/gsk2879552-2hcl.html respectively (p < 0.05; Figure 5). HeLa cells inoculated with wild type A. haemolyticum displayed no increase in apoptosis, as measured by caspase 3/7 or 9 activity (1.12-fold and 0.95-fold increases, respectively; Figure 5). However, HeLa cells inoculated with wild type A. haemolyticum had significantly reduced caspase

8 activity when compared to untreated cells (0.54-fold activity; p < 0.05; Figure 5). HeLa cells inoculated with the pld mutant also displayed similar levels of caspase 3/7, 8 and 9 expression as the

uninoculated HeLa cells (0.85-fold, 1.06-fold and 0.77-fold, respectively; Figure 5). The caspase 3/7 assay was repeated at 1 or 24 h post-invasion, however, no significant differences were observed in activity of these caspases at these time points (data not shown). Therefore, Salubrinal mw it appears that invasion of HeLa cells with A. haemolyticum strains was unable to induce apoptosis under these conditions (Figure 5). Figure 5 Intracellular PLD does not initiate apoptosis in HeLa cells. HeLa cells were inoculated with A. haemolyticum strains and the bacteria were allowed to adhere for 2 h and invade for 5 h prior to measurement of caspase 3/7, 8 or 9 activity. Activity GPX6 is shown as a fold-change of untreated cells, which was set at a nominal value of 1.0. Error bars indicate one standard deviation from the mean calculated from the averages of at least three independent experiments conducted in triplicate. As bacterial invasion did not induce apoptosis, it suggested that loss of HeLa cell viability may be due to necrosis. HeLa cells were inoculated with A. haemolyticum strains and examined by TEM. Uninoculated, control HeLa cells displayed normal architecture (Figure 6A). HeLa cells inoculated with the pld mutant displayed typical cellular architecture; however, bacteria could

be observed in membrane-bound vacuoles within some cells (Figure 6B). In contrast, wild type inoculated cells appeared necrotic, as there was no membrane integrity, the cytoplasm appeared to be absent, the nucleus was condensed and the mitochondria were swollen (Figure 6C, D), all of which are hallmarks of cellular necrosis. Bacteria could be observed both in proximity to, and inside, the HeLa cells, and intracellular bacteria were not found within vacuoles (Figure 6C). Figure 6 PLD apparently induces host cell damage by necrosis. Representative transmission electron micrographs of HeLa cells, (A) uninoculated, or inoculated with (B) A. haemolyticum pld mutant or (C, D) A. haemolyticum wild type using a standard invasion assay. SAHA HDAC solubility dmso Arrows indicate bacteria, N and M indicate the nucleus and mitochondria, respectively.

coli was PRIMA-1MET ic50 found to consistently produce β-galactosidase in the pBLUE TOPO vector in preliminary experiments, and was used as a positive control. Because the arabinose operator was not included in the positive control, the addition of arabinose was not required to produce β-galactosidase. A 49 bp segment of the jamaicamide jamG gene was used as a negative control. [Note: the pBLUE vector contains a

cryptic promoter that is reported to possibly limit the efficacy of assaying other promoter fragments in a prokaryotic host (Invitrogen). However, a series of preliminary assays indicated significant and repeatable differences in promoter activity between possible promoter regions, and baseline activity in the negative control was sufficiently low as to not conflict with the assay results. The BPROM prediction software was used to verify that the vector constructs did not introduce any artificial promoters]. Those regions found to have promoter activity were assayed again with additional dilution (10 fold) to quantify promoter strength, expressed as specific activity (nmol ONPG hydrolyzed min-1 mg soluble protein-1). Isolation of possible transcription

factors from a pulldown assay Protein pulldown experiments were based on methods similar to [53]. A DNA probe that extended from 1000 bp upstream of jamA to 20 bp into the jamA gene was amplified by PCR from the jamaicamide fosmid described above using the primers upjamA 1000 biotin (biotinylated at the 5′ end; Invitrogen) MDV3100 chemical structure and upjamA 20 – 0 R (Additional file 1: Table S1). The PCR product was purified (MinElute PCR Purification Kit, Rucaparib nmr AZD3965 in vivo Qiagen) and 10 pmol of the biotinylated DNA were incubated with 1 mg of magnetic M-270 streptavidin Dynabeads (Invitrogen), according to the manufacturer’s instructions. L. majuscula JHB tissue was obtained from pan cultures that had been growing for 1-2 months. Approximately 2-3 ml of culture was measured by displacement in sterile, chilled binding buffer

[10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 mM DTT, 150 mM NaCl, and 5% (w/v) glycerol]. The binding buffer was also treated with a broad range protease inhibitor (Complete, EDTA free; Roche). The tissue was sonicated and kept on ice using a probe sonicator with six 10-s pulses, and insoluble material was pelleted at 13,200 RPM for 10 minutes. The soluble protein fraction (750 μl) was added to each mg of DNA coated beads. One μg of Poly DI-DC was also added to inhibit non-specific binding of protein to the DNA. Magnetic beads that were not treated with biotinylated DNA were incubated with JHB soluble protein as a negative control. The beads and soluble protein were incubated for 1 h using an end-over-end rotator at 4°C. The beads were subsequently washed twice using 200 μl of binding buffer containing 100 μl sheared salmon sperm DNA (Invitrogen; 5 mg ml-1), three times with binding buffer, and eluted with 50 μl of binding buffer containing 1.0 M NaCl.

Small increases in sea expression were found in the transitional phase at pH 7.0 and

6.5. However, relative sea expression in the transitional phase at pH 6.0 (n = 2) and 5.5 (n = 3) were high, nine and four times higher, respectively, than in the exponential growth phase. At pH 5.5, extended sea mRNA expression was observed with the peak associated with the transitional phase. However, sea mRNA was not possible to detect selleck kinase inhibitor at pH 5.0 or 4.5. Figure 1 Growth and relative sea levels of S. aureus Mu50 when grown at different pH levels. (A) Growth curves determined by OD measurements at 620 nm at pH 7.0, 6.5, 6.0, 5.5, 5.0, and 4.5. (B) Relative expression (RE) of sea at pH 7.0, 6.5, 6.0, and 5.5. Solid and dashed lines represent growth and RE, respectively. For pH 6.0 and 5.5, the mean and standard deviations of independent batch cultures; two and three, respectively, is displayed. Extracellular SEA was detected in all cultivations of S. aureus Mu50 and the levels increased over time at tested

pH levels allowing growth (Figure 2). The SEA levels increased from pH 7.0 to 6.0 and decreased significantly at lower pH levels, i.e. pH 5.5, 5.0 and 4.5. The specific extracellular SEA concentrations (i.e. the extracellular SEA concentrations divided by the value of the OD at that point in time) correlating the SEA production to growth, showed the same trend. The specific SEA concentrations were 100, 450, 510, 210, 40, and 870 ng per ml and OD unit for pH 7.0, 6.5, 6.0, 5.5, 5.0, and 4.5, respectively. The specific SEA concentration at pH 4.5 is misleading since the culture was not growing. Figure 2 SEA levels, growth rate and sea Tanespimycin expression of S. aureus Mu50 at different pH levels. Extracellular why SEA levels in the mid-exponential, the transitional, the early stationary, and late selleck chemicals stationary growth phase;

maximal growth rate (μmax), and relative sea levels (RE) in the transitional phase. At pH 4.5 the SEA values are after 10, 24 and 30 h of growth, shown in the figure as transitional, early stationary and late stationary phase samples, respectively. The values at pH 6.0 and 5.5 are the average and standard deviations of two and three independent batch cultures, respectively. Phage-associated sea expression Samples of bacterial cells and culture supernatants from S. aureus Mu50 were collected to determine the trends of the relative sea gene copy number (and thus the replicative form of the sea-carrying phage) and relative phage copy number in the four growth phases at different pH values (Figure 3). The relative sea gene copy number was low throughout the cultivations at pH 7.0 and 6.5. The sea gene copy number peaked at pH 5.5, being twelve times higher than at pH 7.0 in the mid-exponential growth phase, and a trend of the sea gene copy number decreasing over time was observed at this pH. The sea gene copy number increased over time at pH 5.0 and 4.

The relative risks for men with PVFs were taken from a meta-analysis and were 2.3, 4.4, 1.4 and 1.8 for hip, clinical vertebral, wrist and other fractures, respectively [42]. These relative risks were reduced by 10 % each per decade above the age of 70 years [43]. An increased risk of subsequent fractures was also modelled during the simulation for men who have a prior fracture of the same location, using a previously described method [18]. Strontium ranelate The MALEO Trial has been developed in accordance with European guideline on clinical investigation of medicinal products

(November 2006). This guideline deals with minimal requirement for marketing indication of Selleck ARRY-162 a treatment in osteoporosis in men at increased risk fracture once the marketing indication in PMO women has been already granted to the same drug. The MALEO Trial is a controlled study versus placebo on the basis of calcium/vit D supplementation with BMD measure as primary efficacy criteria and a main analysis after 1 year.

In the MALEO Trial [15], Evofosfamide clinical trial a marked increase in the mean lumbar L2–L4 and femoral neck BMD was observed in men with high risk of fractures, similar to that previously observed in women (Table 2). Considering these results and the previously established relationship between change in BMD and reduction in the risk of vertebral and hip fractures with strontium ranelate in women [44, 45], a similar anti-fracture efficacy is expected in men. We therefore assumed, in the base-case analysis, the same relative risk reduction of fractures in men as those estimated in women (SOTI and TROPOS trials). Table 2 Between treatment comparison Methocarbamol of the percentage change in lumbar spine and femoral neck BMD to month 12 relative to baseline in male https://www.selleckchem.com/products/sc79.html patients from MALEO and in postmenopausal women in SOTI-TROPOS studies Relative change from baseline to M12 Men with osteoporosis PMO women   MALEO N=261 (15) TROPOS N=5,091 (7) SOTI N=1,649 (5) Lumbar spine BMD N 197 3807 1361 E (SE) 6.2 (0.8)% 7.0 (0.2)% 7.2 (0.4)% 95 % CI [4.7–7.8]

[6.6–7.4] [6.5–7.9] p value p<0.001 p<0.001 p<0.001 Femoral neck BMD N 178 3,759 1,326 E (SE) 3.2 (0.7)% 3.6 (0.2)% 3.3 (0.2)% 95 % CI [1.8–4.6] [3.3–3.9] [2.8–3.8] p value p<0.001 p<0.001 p<0.001 N number of patients with evaluation at both baseline and M12 visits, E (SE) estimate and standard error of the adjusted mean difference (strontium ranelate vs. placebo), CI confidence interval of the estimate, PMO Post-menopausal osteoporosis In most cost-effectiveness analyses, efficacy data were retrieved from the entire population of the randomized clinical trials and the modelers charged the full treatment cost. Although, in real-life settings, adherence is far from optimal, this assumption may be incorrect to estimate the potential economic value of a drug and probably underestimates the true underlying risk reduction with therapy since the efficacy from these trials is reduced to some degree because of non-adherence.

Achim Trebst had realized the

potential of molecular genetics in understanding photosynthesis and bioenergetics. He was interested in sequences rather than genetics itself. Owing to molecular genetics, amino acid selleck chemical sequences were now easily available. He was fascinated by the possibility of finding the clue to molecular mechanisms of proteins by inspection of the structures. Since no three dimensional structures were known yet, Achim attempted to imagine—based on primary structures—three dimensional structures of catalytic centers. This work was a highly satisfying ‘game’, as well as an intellectual challenge. In this context, intensive collaboration with William Cramer must be mentioned. I remember a seminar in 1986 where Achim presented a model made of metal rods, showing the possible three dimensional structure of the catalytic part of the cytochrome b/f Mdivi1 complex that included the presumed location of the heme groups. Tideglusib By means of this model, he predicted a convincing mechanism of electron transport

within this complex. Nowadays, since three dimensional structures at atomic resolution are available, we may be surprised to notice how good his predictions were. Amazingly, the chemist Trebst also contributed to evolution, the classical field of biologists. He was the first to point to the molecular relationship between the photosynthetic cytochrome b/f complex and the mitochondrial b/c complex and he emphasized the molecular relationship between Photosystem II of plants and the photosystem of purple bacteria. This finding taught us that evolution is an economical process. Innovations often originate just by new combination of ‘approved’ elements. A logical mind, imagination and intuition are important attributes of a great scientist. Achim Trebst possesses a lot of them. These qualities enabled him to accomplish a significant scientific opus. Moreover Achim donated his wonderful gifts to others, taught and inspired them. He discusses scientific issues with intellectual sharpness, but always within the rules

of fairness. Decency is a self-evident attitude of Achim. Achim Trebst Org 27569 was and is an esteemed guest in many universities and research institutions around the world. Often he is in Sweden (Stockholm), USA (Berkeley; Lafayette) and in Israel (the Weizmann Institute in Rehovot, the Hebrew University in Jerusalem, the Desert Research Institute in Sde Boqer). For him the friendship with Israeli colleagues is of special significance. Once, in a small symposium in Bochum, he introduced Itzhak Ohad from Jerusalem and himself as the “special pair”. Photosynthesis people know the meaning of special pair. Here, we were also reminded of the fruitful period of Jewish and non-Jewish German collaboration in science before it was brutally terminated. Achim suffers from this cruel period of German history.

J Mater Chem 2011, 21:6020.CrossRef 14. Zhang SB, Wei SH, Zunger A: Intrinsic n -type versus p -type doping asymmetry and the defect physics of ZnO. Phys Rev B 2001, 63:075205.CrossRef 15. Zhang Y, Wang LW, Mascarenhas A: “”Quantum coaxial cables”" for solar energy harvesting. Nano Lett 2007, 7:1264.CrossRef 16. Aranovich JA, Golmayo D, Fahrenbruchn AL, Bube RH: Photovoltaic properties of ZnO/CdTe heterojunctions prepared by spray pyrolysis. J Appl Phys 1980, 51:4260–4268.CrossRef 17. Jasieniak J, MacDonald BI, Watkins SE, Mulvaney P: Solution-processed sintered nanocrystal solar cells via layer-by-layer assembly. Nano Lett 2011, 11:2856–2864.CrossRef 18. Panthani MG, Kurley JM, Crisp RW, Dietz TC, Ezzyat T, Luther JM, Talapin

DV: High efficiency solution processed sintered CdTe nanocrystal solar cells: the role of interfaces. Nano Lett 2014, 14:670–675.CrossRef 19. Lee SH, Zhang XG, Parish CM, Lee HN, Smith DB, He Y, Xu J: Nanocone

tip-film see more solar cells with efficient charge transport. Adv Mater 2011, 23:4381–4385.CrossRef 20. Michallon J, Zanuccoli M, Kaminski A, Consonni V, Morand A, Bucci D, Emieux F, Szambolics H, Perraud S, Semenikhin I: Comparison of optical properties of Si and ZnO/CdTe core/shell nanowire arrays. Mater Sci Eng B 2013, 178:665.CrossRef 21. Lévy-Clément C, Katty A, Bastide S, Zenia F, Mora I, Munoz-Sanjose V: A new CdTe/ZnO columnar composite film for Eta -solar cells. Phys E 2002, 14:229.CrossRef 22. Tena-Zaera R, Katty A, Bastide S, Lévy-Clément C, O’Regan B, Muñoz-Sanjosé V: ZnO/CdTe/CuSCN: a promising heterostructure to act as inorganic eta -solar cell. Thin Solid Films 2005, 483:372–377.CrossRef 23. Aga RS, Jowhar D, Selleck Quisinostat Ueda A, Pan Z, Collins WE, Mu R, Singer KD, Shen J: Enhanced photoresponse in ZnO nanowires decorated with CdTe quantum dot. Appl Phys Lett 2007, 91:232108.CrossRef 24. Cao X, Chen P, Guo Y: Decoration of textured ZnO nanowires array with CdTe quantum dots: enhanced light-trapping effect and buy Sotrastaurin photogenerated

charge separation. J Phys Chem C 2008, Fenbendazole 112:20560–20566.CrossRef 25. Aga RS, Gunther D, Ueda A, Pan Z, Collins WE, Mu R, Singer KD: Increased short circuit current in organic photovoltaic using high-surface area electrode based on ZnO nanowires decorated with CdTe quantum dots. Nanotechnol 2009, 20:465204.CrossRef 26. Chen HM, Chen CK, Chang YC, Tsai CW, Liu RS, Hu SF, Chang WS, Chen KH: Quantum dot monolayer sensitized ZnO nanowire-array photoelectrodes: true efficiency for water splitting. Angew Chem 2010, 122:6102–6105.CrossRef 27. Wang X, Zhu H, Xu Y, Wang H, Tao Y, Hark S, Xiao X, Li Q: Aligned ZnO/CdTe core-shell nanocable arrays on indium tin oxide: synthesis and photoelectrochemical properties. ACS Nano 2010, 4:3302.CrossRef 28. Chen ZH, Liu CP, Wang HE, Tang YB, Liu ZT, Zhang WJ, Lee ST, Zapien JA, Bello I: Electronic structure at the interfaces of vertically aligned zinc oxide nanowires and sensitizing layers in photochemical solar cells. J Phys D Appl Phys 2011, 44:325108.CrossRef 29.