Five variants (types I–V) of the fimA were classified on the basis of the nucleotide sequences (Nakagawa Pirfenidone ic50 et al., 2000). Polymerase

chain reaction (PCR) assay using each genotype-specific primer set was generated and has been employed for more than 10 years to determine fimA types in subjects with various periodontal and systemic conditions (Amano et al., 1999; Nakagawa et al., 2000, 2002; Beikler et al., 2003; Missailidis et al., 2004; Miura et al., 2005; Davila-Perez et al., 2007). In 2002, a new variant of fimA was also cloned from P. gingivalis strain HG1691, which was designated as type Ib fimA. The nucleotide sequence of type Ib fimA shared 97.1% and 77.5% homology with those of type I and II fimA, respectively (Nakagawa et al., Panobinostat ic50 2002). Therefore, genotyping primer sets for types I and II fimA often cross-reacted with type Ib fimA. It was impossible to distinguish type Ib fimA from type I fimA only by PCR assay using type-specific primers. To probe type Ib fimA, a new method of RsaI digestion, following PCR with a new primer set (type

Ib) was developed (Nakagawa et al., 2002). The 271-bp fragments are amplified from P. gingivalis strains harboring type I as well as type Ib fimA using the new type Ib primers. Only the fragment amplified from type Ib fimA can be digested with RsaI, resulting in 162 and 109 bp fragments. Porphyromonas gingivalis with type Ib fimA has been shown to be closely associated with periodontitis, similar to organisms with type II fimA, which is the most prevalent fimA type in periodontitis patients (Nakagawa et al., 2002; Missailidis et al., 2004; Miura et al., 2005). Therefore,

accurate detection of type Ib and II fimA is critical to more clearly elucidate any important relationship between particular fimA genotype and periodontitis. However, the potential for false type II fimA-positives caused by cross-hybridization of type II fimA-specific primers with type Ib fimA has complicated the genotyping (Nakagawa et al., 2002; Nintedanib (BIBF 1120) Enersen et al., 2008). Here, we report newly designed type II fimA-specific primers that exclude false type II fimA-amplicons derived from type Ib fimA. The previous reverse primer for type I, II, III and IV fimA is common to all of the fimA types as a fimA-specific conserved sequence, which is located downstream from the stop codon (Amano et al., 1999; Enersen et al., 2008), and the alignment for the previous type II forward primer is found to be shared in the coding region of type II as well as type Ib fimA (Supporting Information, Fig. S1). To avoid nonspecific amplification, we designed a new primer set specific for type II fimA based on the fimA sequence of strain HW24D1 [DNA Data Bank of Japan (DDBJ) accession no. D17797]; type II (new)-F, GCATGATGGTACTCCTTTGA; type II (new)-R, CTGACCAACGAGAACCCACT. The sequence specificity of the type II (new) primers was checked by BLAST based on the DNA sequence information stored in GeneBank. The specificity of the new primers was examined using P.

While fluconazole is usually

active against Candida albicans, non-Candida albicans species often require more sophisticated approaches. A rapid species diagnosis is therefore desirable and can be provided by fluorescence in situ hybridisation (FISH). However, broad evaluation studies of described probes are largely lacking and the probe panel that has been described is incomplete. As an addition to previously described C. albicans FISH probes, we evaluated published DNA probes for C. glabrata and C. krusei, as well as newly Ganetespib designed DNA probes for C. krusei, C. lusitaniae, C. parapsilosis, C. tropicalis, Crypotococcus neoformans and a group of intrinsically fluconazole-resistant Candida species for FISH with 22 reference strains, 23 well-characterised laboratory control strains, 169 isolates from clinical samples and 48 blood cultures. Sensitivity and specificity of >99% were demonstrated for all evaluated Palbociclib species-specific probes, whereas the probe that binds to a heterogeneous group of intrinsically fluconazole-resistant Candida species correctly identified eight of nine fluconazole-resistant clinical isolates. FISH yielded reliable results using the classical FISH procedure as well as a recently described slide chamber-based method. Given this good sensitivity and specificity, FISH may be applied for rapid identification of yeast in screening analyses, thus

giving the opportunity for more precise targeting of antimycotic therapy. “
“Candida

species are the fourth most common cause of nosocomial bloodstream infections. An increase in the frequency of infections, which have become refractory to standard antifungal therapy, has been observed. Recent studies have shown that the pro-oxidant properties of diphenyl diselenide (PhSe)2, a structurally simple organoselenium compound, can be toxic to yeast. The objective of this work was to study, under non-reactive oxygen species (ROS)-generating conditions, the effect of different organochalcogenide mafosfamide compounds [(PhSe)2, (PhTe)2, (MeOPhSe)2, (p-Cl-PhSe)2 and (F3CPhSe)2] on growth and germ tube formation by Candida albicans. A decrease in C. albicans growth in the presence of crescent concentrations of (PhSe)2, (PhTe)2 and (MeOPhSe)2 was observed. The organochalcogenide compound concentration needed to inhibit 50% (IC50) of the Candida growth was 0.5–2 and 2–10 μmol l−1, at a cell density of 105 and 106 cells ml−1, respectively. The compounds (p-Cl-PhSe)2 and (F3CPhSe)2 were able to inhibit the cell growth, although the inhibition was considerably weaker than that by (PhSe)2, (PhTe)2 and (MeOPhSe)2. In Candida suspensions incubated in a medium containing serum as an inducer of germ tube formation, the presence of either (PhSe)2 or (MeOPhSe)2 at 10 μmol l−1 completely inhibited the number of cells which formed germ tubes. These results demonstrate the potential of organochalcogenide compounds to inhibit both C.

Intracytoplasmic cytokines can be measured following mitogen stimulation of immune cells, addition AZD1208 order of a monoclonal antibody directed against the cytokine of interest, and then FACS analysis. Positive cells are expressed as percentage of cytokine-producing cells within the T-cell population. An advantage of this technique is the potential to simultaneously distinguish lymphocyte phenotype.5 A study of 14 kidney transplant patients treated with a CNI, azathioprine and prednisolone demonstrated significantly lower frequencies of IL-2 secreting CD4+ and CD8+ T

cells and IFN-γ and double positive IL-2/IFN-γ secreting CD4+ T cells at 3 and 6 months post-transplantation compared with pre-transplantation.5 This study also showed that the frequency of IL-2 secreting Ipatasertib price T cells was more

affected by tacrolimus than cyclosporine, again suggesting increased immunosuppressive potency of the former drug. In a study of 41 kidney transplant recipients treated with a CNI, azathioprine (n = 4) or MMF (n = 37) and corticosteroids, a reduction in the frequencies of IL-2, IFN-γ and TNF-α secreting CD4+ and CD8+ T cells was seen in the first 14 days post-transplantation compared with at baseline.8 However, in contrast to the previous study, variable increases in most of these T-cell frequencies were seen thereafter, with IFN-γ secreting T-cell frequencies increasing all the way Phosphoglycerate kinase back to baseline levels by 1 year. This raises concern that this measure of cytokine secretion may not be sufficiently sensitive to quantify immunosuppression in patients some time from transplantation. Consistent with data from studies using ELISA, studies using flow cytometry have failed to detect an effect of MMF monotherapy on cytokine secretion (IL-2 and TNF-α).10 The ELISPOT identifies and enumerates cytokine-producing cells at the single-cell level. It has increased sensitivity compared with conventional ELISA and flow cytometry, being able to detect as few as 10 cytokine secreting T cells per 1 million peripheral blood mononuclear cells (PBMCs).50 However, it has a lower dynamic range, making it less able to quantify the magnitude of

a response.51 Although multiple studies have shown an association between ELISPOT reactivity to donor antigens and clinical outcomes, only one study has investigated ELISPOT reactivity following non-specific mitogen stimulation. Following PHA stimulation of PBMC, no difference was found in the number of IFN-γ (as a surrogate for Th1 immunity) or IL-5 (as a surrogate for Th2 immunity) secreting cells between dialysis patients, kidney transplant recipients and healthy controls.16 However, in a subset of 23 kidney transplant recipients with acute graft dysfunction, 8 of 12 cases with rejection had PBMC IFN-γ/IL-5 ratios >15, whereas 10 of 11 cases of graft dysfunction from other causes were associated with ratios of <15 (P = 0.07).

NF-κB activation in piglet epithelium occurred in both Selleck Crizotinib infected and uninfected epithelial cells whereas in a human epithelial cell line activation of NF-κB took place exclusively in infected cells [48]. In the piglet epithelium, a key step in initiating apoptosis did occur, the cleavage

of caspase-3, but the enzyme function was prevented by the binding of an apoptotic inhibitor XIAP and proteasome activity. At the villus tips, NF-κB activation was less pronounced in cells being shed into the gut lumen and most of these cells were apoptotic. This indicated that repression of apoptosis except at the villus tips allows elimination of infected cells in a controlled manner that minimized damage to the epithelial barrier function [50]. These observations with infected piglets emphasize a need for caution in the interpretation of findings obtained with

infected epithelial cell lines. Human or murine intestinal epithelial cell lines infected with C. parvum demonstrate an inflammatory response characterized in particular by production of numerous CC and CXC chemokines [25, 51]. With infected murine cells, chemokines expressed following infection induced migration of bone marrow-derived dendritic cells towards BMN 673 supplier the infected epithelial cells [52]. This early expression of chemokines could be a key factor for the establishment of inflammation following infection in vivo. In addition, chemokine production by epithelial cells is amplified by cytokines, including IFN-γ [53], which as discussed above is a key cytokine in immunity to Cryptosporidium. Epithelial cells may also exhibit antimicrobial killing mechanisms that could affect the viability of Cryptosporidium. The antimicrobial peptides expressed by human epithelial cells, β-defensin-1 and -2, have been shown to induce click here lysis of C. parvum sporozoites and inhibit infection in vitro [54]. Infection of bovine calves with C. parvum induced expression of a β-defensin in intestinal epithelium [55]. However, C. parvum

infection of a human intestinal epithelial cell line affected expression of β-defensins in different ways [54]. Infection of the human intestinal epithelial cell line Caco-2 induced the expression of β-defensin-2 but down-regulated expression of β-defensin-1. During infection of the murine intestinal epithelial cell line CMT-93 or neonatal mice, there was reduced expression of murine β-defensin-1 [54]. Hence, antimicrobial peptides might play an important role in limiting C. parvum development whereas the infection may directly or indirectly modulate expression of different peptides. Piglets infected by C. parvum were shown to have increased NF-κB-dependent intestinal expression of iNOS and NO production [56].

8% to 29.6%, the prevalence of PCV2 viremia ranging from 71.4% to 78.6% between 7 and 21 dpc. In addition, except for the PO-PCV2-I group, the mean group PCV2 antigen amount in tissues was reduced by PCV2 vaccination. The differences in vaccine efficacy between the two different administration buy Crenolanib routes may be attributable to the interval between vaccination and challenge (4 weeks). The PO vaccination route appeared to induce a delayed antibody response suggesting that a longer interval is needed between vaccination and challenge. Alternatively, a higher dose may be required for induction of greater protective immunity with this route. In

conclusion, under the conditions of this study, an experimental live-attenuated PCV2 vaccine was safe and efficacious when used IM in a PCV2b-PRRSV dual-challenge model. Administration of the same product

PO resulted in a lower level and delayed onset of protective immunity compared to IM administration. More Gefitinib studies are needed to improve the immunogenicity of the oral vaccine. We thank the National Pork Board Pork Checkoff Dollars for funding of this study. We also thank Shayleen Schalk and Matthew Umphress for assistance with the animal work. None of the authors of this paper have any financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper. “
“It has not been considered so far that antigen-presenting cells (APC) may phagocytose immunogenic material from autologous cancer cells. Assuming the presence of cancer-immunogenic material Sinomenine in APC, we developed a novel autologous priming method that does not require tumour cells or identified peptides. Cancer-immunogenic information came from CD14+ monocytes. When stimulated with CD3-activated T cells, monocytes primed CD3+CD4+ and CD3+CD8+ resting/naïve

T cells to become powerful effector cells within 24 h. During priming, depletion of CD14+ monocytes but not CD1a+ CD83+ dendritic cells prevented T cell priming. During cancer cell destruction, dendritic cells, but not monocytes, enhanced cancer cell lysis. The cascade-primed (CAPRI) immune cell quartet comprising monocytes, dendritic cells, CD4+ T and CD8+ T cells induced a significant decrease in the number of suppressive CD25highFoxP3+CD4+ T cells. CAPRI cells induced a marked upregulation of MHC class I and class II expression in cancer cells, which is crucial for autoimmune-like lysis. We show in vivo evidence of the CAPRI cell concept in nude mice. In humans, we present circumstantial clinical evidence showing the efficacy of CAPRI cells in an adjuvant treatment attempt for breast cancer patients with metastasis (N = 42). Compared to patients at the Munich Tumor Center (no CAPRI treatment N = 428), almost double the expected number of patients survived 5 years (P = 1.36 × 10−14). The CAPRI method is a safe procedure without negative side effects.

As shown in Fig. 5A, TLR ligands, TNF or CD40L had a variable effect on MoDC differentiation by day 2 and none of the stimuli led to a substantial increase in apoptosis. Ligation of TLR2 by zymosan, or HKSA and the TLR7/8 ligand CL075, led to the retention of high CD14 expression on a subset of cells and blocked CD1a expression. Other signals, however, did not have a major impact on MoDC differentiation markers despite their ability to decrease the sensitivity to further activation (Fig. 1). Monocyte activation may thus prevent DC differentiation

in the case of some particular TLR ligands; however, such effect does not fully overlap with the tolerizing ability of the different stimuli. In order to identify which TLR-induced signaling pathways selleck kinase inhibitor are impaired in MoDCs that received an early LPS stimulation buy PD0325901 we

studied MAPK, NF-κB and IRF-3 activations in these cells. Activation of MAPKs is attributed to signals transmitted by the Myd88-dependent arm of the TLR pathways that might be particularly affected by the downmodulation of IRAK-1. Accordingly, LPS-induced phosphorylation of the Erk1/2 and p38 kinases, as well as phosphorylation of CREB/ATF-1 transcription factors, often occurring via p38 activation, were abrogated by LPS pre-treatment of developing MoDCs (Fig. 5B). On the contrary, DCs differentiating in the absence of LPS responded readily with Erk1/2, p38 and CREB/ATF-1 phosphorylation to LPS stimulation. The primary step of NF-κB activation is the phosphorylation-dependent degradation of the IκB components, a prerequisite for NF-κB nuclear translocation 29. Interestingly, LPS-induced IκBα phosphorylation occurred similarly in LPS pre-treated and control MoDCs and we did not detect a different level of the total IκBα protein in these

samples either (Fig. 5C). These results indicate that NF-κB might be activated by TLR-dependent signals in LPS-tolerized MoDCs. Further activity of NF-κB is tuned by enzymatic modifications that almost include phosphorylation at multiple residues. The NF-κB subunit p65 is phosphorylated at S276 in order to gain strong transcriptional activity, whereas its functions are further modulated by phosphorylations at other sites of the protein 30. We found a similar S276 and S536 phophorylation in response to LPS in both LPS pre-treated and control MoDCs (Fig. 5C). S529 phosphorylation was, on the other hand, inhibited in LPS-pretreated DCs, indicating a partial impairment of NF-κB regulation following persistent LPS signals. However, functional significance of S529 phosphorylation is not known. The partial activation of NF-κB in spite of the decreased Myd88-dependent signal transduction might indicate functional MyD88-independent, TRIF-dependent signal routes. Indeed, we found a strong IRF-3 phosphorylation in response to TLR3 or TLR4 ligation by poly(I:C) and LPS, respectively, in both LPS-pretreated and control MoDCs (Fig. 5D). IRF-3 phosphorylation was rather elevated in LPS–pre-treated cells (3.8- and 2.

Patient management following microsurgical flap failure includes strategic abandonment of reconstruction in some cases, use of conventional procedures in a majority of cases, and further microsurgical procedures in one-third of cases. The reconstructive surgeon should have this range of possibilities available for these difficult

cases. © 2009 Wiley-Liss, Inc. Microsurgery, 2010. “
“The aim of this study was to investigate the correlation between contractile function recovery and changes of acetylcholine receptors (AChR) in a transferred muscle flap following reinnervation. Orthotopic transfer of the gracilis muscle flap with repair of its nerve was performed bilaterally in 48 rats. The rats were randomly divided into six experimental groups based on the time intervals for assessments (1, 4, 5, 10, 20, and 30 weeks). Sixteen LY2157299 manufacturer Vismodegib in vitro gracilis muscle samples from eight rats without surgery were used as the controls. In each group, muscle contractile force and weight were measured

(n = 16). The AChR numbers (n = 8) and subunits (ϵ and γ) mRNA (n = 8) were examined using [125I]-α-bungarotoxin and fluorescent quantitative-PCR. The results showed the AChR numbers in the muscle flap increased from 4 to 20 weeks after reinnervation and correlated with recovery of the tetanic contraction force. However, correlation between the increase of AChR number with the specific tension (peak contractile force normalized to wet muscle weight) was only found from 4 to 10 weeks postoperatively. The expression of γ-subunit mRNA increased at the early period after flap transfer and then decreased rapidly, whereas the ϵ-subunit mRNA recovered gradually since fourth week postoperatively. A small amount of γ-subunit mRNA could still be detected at 30 weeks

after surgery. In conclusion, following reinnervation of the transferred muscle flap, the contractile functional recovery is partially correlated to increase of the AChRϵ. Our findings may provide evidence for further study of improving muscle function in functional reconstruction Glutamate dehydrogenase by targeting the AChR. © 2010 Wiley-Liss, Inc. Microsurgery 2010. “
“We report the case of a 46-year-old patient who suffered from huge tophus masses involving the metatarsal joints of the big toes of both feet, with infection and skin necrosis secondary to chronic tophaceous gout. After conventional curettage and debridement of each lesion, a free anterolateral thigh flap (ALTF) was used to resurface the circumferential wound, protect the underlying structures, and provide a gliding surface for the exposed tendons. The flap was safely raised and debulked during revision surgery, and excellent functional and cosmetic results were apparent at the 2-year follow-up. We consider ALTF to be a valuable option for the coverage of necrotic skin over tophi after adequate debridement. © 2009 Wiley-Liss, Inc.

Plasmacytoid DC (pDC) are bone marrow-derived leukocytes that secrete type I IFN (IFN-I) 1, 2. pDC detect Lapatinib RNA and DNA from viruses and RNA/DNA/immunocomplexes through two endosomal sensors, TLR7

and TLR9, respectively, both of which induce secretion of IFN-I through the MyD88-IRF7 signaling pathway 3–5. pDC were first identified in humans as CD4+, CD68+ and IL-3R+ (CD123) plasma cell-like cells 6. Initially, it was unclear what functions these cells perform in vivo; however, pDC’s prominent endoplasmic reticulum suggested a role in cytokine secretion. Later, it was demonstrated that this unique subset could differentiate into Ag-presenting cells 7, 8 and specialize in the secretion of IFN-I, thus corresponding to the human natural IFN-producing cells 9, 10. In 2001, cells that resembled human pDC were finally identified in the mouse 11. pDC originate in the bone marrow from common lymphoid/myeloid progenitors and are dependent on Flt3L, STAT3 and the transcription factor E2-2 for development 12. pDC, similar to committed precursors of classical DC, enter lymphoid organs directly from the blood through the high endothelial venules 13–15. Under homeostatic click here conditions, pDC also inhabit mucosal tissues and organs, albeit at low numbers. pDC accumulation in lymphoid tissues, mucosa and organs occurs during several human pathologies, particularly in LN of patients affected by

sarcoidosis, Mycobacterium tuberculosis infection 16, Kikuchi’s disease 17, and in the skin of patients affected by psoriasis 18, 19, systemic lupus erythematosus (SLE) 20 and lichen planus 21, 22. pDC accumulation has also been observed in brain lesions of patients with multiple sclerosis 23, in the salivary glands of patients with

Sjogren’s syndrome 24 and the synovia or inflamed muscle tissue/skin of people afflicted with rheumatoid arthritis 25, 26 or dermatomyositis 27, 28, respectively. pDC are over-represented in Selleckchem Afatinib the blood of patients with type I diabetes around the time of onset 29. pDC also infiltrate tumors 30–37 and are recruited to infected sites during viral infections caused by herpes zoster virus 38, HCV 39 and herpes simplex virus 40. The accumulation of pDC has been observed in many animal models of disease. During influenza 41–43 and RSV 44, 45 infections, pDC are recruited to the lungs and draining LN of mice. pDC numbers increase in the pancreatic LN around the onset of diabetes in NOD mice 46 and in the pancreas during lymphocytic choriomeningitis virus infection 47. In mouse models of HSV infection, pDC accumulate in the LN following footpad infection with HSV-1 48 and in the vaginal mucosa during HSV-2 infection 49. pDC are also recruited to the vaginal mucosa of rhesus macaques intravaginally infected with SIV 50. Furthermore, it has been reported that pDC infiltrate LN during SIV infection 51, 52.

Cells were washed twice with degassed sample buffer and resuspended in 90 μl of the sample buffer. The cell suspension was then incubated with 10 μl MACS anti-rat IgG MicroBeads (Miltenyi Biotech) at 4° for 15 min. The cell–bead suspension was washed by centrifugation and the cell–bead complex was check details resuspended in 500 μl degassed sample buffer. The sample was then applied to a MACS MS+ selection column (Miltenyi Biotech) in the presence of the MiniMACS high-energy permanent magnet (Miltenyi Biotech).

The negative (non-GP2 binding) cells were allowed to flow through the column. The column was washed five times with degassed sample buffer and the fractions were pooled with Everolimus in vitro the negative cells. The magnet was then removed and the positive (GP2 binding) cells were flushed out of the column. Both positive and negative samples were assessed for viability and enrichment using the Countess® Automated Cell Counter (Invitrogen). Cells were then resuspended in Lysis/Binding Buffer and the gene expression of Gp2 and Egr1 was assessed

by qRT-PCR (see Supplementary material, Table S1 for primer sequences). Frozen intestinal sections were cut into 10-μm thick sections, which were fixed with 10% neutral buffered formalin (Sigma) and then permeabilized with 0·2% Triton-X-100 (Sigma). The plant lectin Ulex europaeus agglutinin 1 (UEA-1) was used to stain M cells. UEA-1-FITC (Vector Laboratories Ltd, Peterborough, UK) was added to cells at a concentration of 10 μg/ml. Cells were then counterstained with 0·165 μm DAPI (Molecular Probes). Cells were mounted with ProLong® Gold anti-fade reagent using No. 1·5 coverslips. Slides were viewed with an Olympus FV1000 confocal laser scanning microscope (Olympus, Hamburg, Germany). THP-1 monocytes

(monocytic leukaemia cell line; ATCC, TIB 202) maintained in RPMI-1640 (Gibco) supplemented with 10% FBS, 100 μg/ml penicillin, 100 U/ml streptomycin and 0·05 mm 2-mercaptoethanol (Gibco) were seeded in six-well tissue culture dishes (Sarstedt, Nümbrecht, Reverse transcriptase Germany) at a concentration of 1 × 106 cells/ml. Bacteria were cultured overnight, washed twice by centrifugation (3200 g for 10 min), and resuspended in PBS at a final concentration of 1 × 109 colony-forming units/ml. Bacteria (1 ml) were labelled with 10 μm carboxyfluorescein diacetate succinimidyl ester (CFSE, CellTrace™ Cell Proliferation Kit; Molecular Probes) for 15 min. Bacteria were then biotinylated using No-Weigh™N-hydroxysulphosuccinimide (Sulfo-NHS)-Biotin (Pierce, Thermo Scientific, Rockford, IL) according to the manufacturer’s instructions. The CFSE-labelled-biotinylated bacteria were added to the THP-1 cells at a multiplicity of infection of 10 : 1 and THP-1 cells and bacteria were co-incubated for 16 hr at 37° with 5% CO2.

(B) Both cska and non-cska-TCRs are degraded in the lysosome following activation. Splenocytes, were non-activated or activated as in (A), in the absence or presence of the lysosomal inhibitor NH 4 Cl, lysed and processed as in (A) for detection of ζ and ZAP-70. (C) Accumulation of cska ζ in activated T-cells following treatment

with NH 4 Cl. Average values and standard deviation were determined from six independent experiments, using ζ expression level of non-activated, NH 4 Cl untreated samples as 100%. Figure S8. FACS gateing strategy. Decitabine In all the FACS results presented in the paper, the first gate distinguished between live and dead/debreas cells (A). The cells were stained using anti-Thy 1.2 antibodies, which enabeled us to focuse on the T cells by gating on the positive population or on the APCs (LK cells in the mixed experiment) by focusing on the negetive population (B). The result was obtained by integreating gate 1 and gate 2 as in the presented sample presented (C). “
“Chronic myelogenous leukemia (CML) is a malignant myeloproliferative disease of hematopoietic stem cells. The disease progresses after several years from an initial chronic phase to a blast phase. Leukemia-specific T cells are regularly detected in CML patients and may be involved in the immunological control of the

disease. Here, we analyzed the role see more of leukemia-specific CD8+ T cells in CML disease control and the mechanism that maintains CD8+ T-cell immunosurveillance in a retroviral-induced murine

CML model. To study antigen-specific immune responses, the glycoprotein of the lymphocytic choriomeningitis virus was used as model leukemia antigen. Leukemia-specific CTL activity was detectable in vivo in CML mice and depletion of CD8+ T cells rapidly led to disease progression. CML-specific CTL were characterized by the expression of the IL-7 receptor Exoribonuclease α-chain. In addition, leukemia cells produced IL-7 that was crucial for the maintenance of leukemia-specific CTL and for disease control. Therefore, CML cells maintain the specific CD8+ T-cell-mediated immune control by IL-7 secretion. This results in prolonged control of disease and probably contributes to the characteristic chronic phase of the disease. Chronic myelogenous leukemia (CML) is a malignant clonal disease originating from a pluripotent hematopoietic stem cell expressing the reciprocal translocation t(9;22), which forms the oncogenic BCR/ABL fusion protein. BCR/ABL is a constitutively activated tyrosine kinase which plays a critical role in the pathogenesis of CML. After several years and acquisition of a second genetic abnormality, the disease progresses from the chronic phase to terminal blast phase in which the patients develop an acute leukemia of either myeloid (AML) or, less frequent, lymphoid (ALL) cell type 1–3. For unknown reasons, CML seems to be the most immunogenic leukemia.