The consent was obtained from parents of each neonate prior to enrolment. The stool samples from 75 randomly selected LBW neonates were used to study gut colonization with ESBL, AmpC and carbapenemase find more producing Enterobacteriaceae. The inclusion criteria were vaginally delivered, healthy and exclusively breast fed LBW neonates. The exclusion criteria were

gross congenital malformations, hospitalization, prematurity, predisposing factors for sepsis, antibiotics use by mother during pregnancy and neonates during study period. After discharge from the hospital, trained field workers visited the newborns for probiotic supplementation, collection of stool sample and related complications up to 60 days of life. The study was duly approved by ethical committee of Safdarjung Hospital. Study of colonization by Enterobacteriaceae Stool samples were collected on Day (D) 1, 21 and 60, serially diluted and plated on McConkey agar without antibiotic to study dominant gut flora. D1 sample is the first stool passed after birth (meconium). Different colony types of gram negative bacteria which were judged to differ in NVP-BGJ398 cost morphology (size, shape, consistency selleck and colour) from each sample

were enumerated separately and identified using conventional biochemical tests. Phenotypic assessment and molecular characterization of antimicrobial susceptibility All Enterobacteriaceae isolated were screened for ESBL using disk diffusion and Etest methods (AB BIODISK, Solna, Sweden) and plasmid mediated AmpC or hyperproduction using AmpC disc test [12]. In 27 randomly selected neonates Enterobacteriaceae were characterised for ESBL (bla TEM , bla SHV (self designed, Table 1), bla CTX-M [group1, 2, 8, 9 and 25]) [13] and ampC (MOX, CIT, DHA, ACC, EBC, and FOX) [14] genes. Table 1 Primers used for detection of TEM, SHV and Carbapenemase genes Primers Primer Sequence (5′ to 3′ direction) Annealing Amplicon size     Temperature

(°C) (bp) TEM FP- ATG AGT ATT CAA CAT TTC CG 50 858   RP- CCA ATG CTT AAT CAG TGA GG     SHV FP- ATG CGT TAT ATT CGC CTG TG 58 862 all   RP- AGC GTT GCC AGT GCT CGA TC     KPC-1 FP- AGC CGT TAC AGC CTC TGG AG 55 1351   RP- GAT GGG ATT GCG TCA GTT CAG     KPC-2 FP- CAC TGT ATC GCC GTC TAG TTC 55 812   RP- TGT GCT TGT CAT CCT TGT TAG     NDM-1 FP- CGACGATTGGCCAGCAAATG 58 551   RP- ACTTGGCCTTGCTGTCCTTG     IMP FP- TTGAAAAGCTTGATGAAGGCG 58 616   RP- ACCGCCTGCTCTAATGTAAG     VIM FP- TTGACCGCGTCTATCATGGC 58 762 Carbapenemase screening All neonates were screened for gut colonization by carbapenem resistant Enterobacteriaceae (CRE) using 2-step broth enrichment method incorporating 10 μg meropenem disc [15]. Suspected CRE isolates with resistance to any one carbapenem [16] i.e. ertapenem (Minimum inhibitory concentration (MIC) > 0.